Nucleotide Sequences of 5S rRNAs from four jellyfishes

نویسندگان
چکیده

برای دانلود باید عضویت طلایی داشته باشید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

The nucleotide sequences of 5S rRNAs from three ciliated protozoa.

The nucleotide sequences of 5S rRNAs from three ciliated protozoa, Paramecium tetraurelia, Tetrahymena thermophila and Blepharisma japonicum have been determined. All of them are 120 nucleotides long and the sequence of probable tRNA binding site of position 41-44 is GAAC which is characteristic of the plant 5S rRNAs. The sequence similarity percents are 87% (Paramecium/Tetrahymena), 86% (Param...

متن کامل

The nucleotide sequences of 5S rRNAs from a sea-cucumber, a starfish and a sea-urchin.

The nucleotide sequences of 5S rRNA from three echinoderms, a sea-cucumber Stichopus oshimae, a starfish Asterina pectinifera and a sea-urchin Hemicentrotus pulcherrimus have been determined. These 5S rRNAs are all 120 nucleotides long. The echinoderm sequences are more related to the sequences of proterostomes animals such as mollusc, annelids and some others (87% identity on average) than to ...

متن کامل

The nucleotide sequences of 5S rRNAs from two red algae, Gracilaria compressa and Porphyra tenera.

The nucleotide sequences of 5S rRNA from two red algae, Gracilaria compressa and Porphyra tenera have been determined. The two 5S rRNAs are fairly dissimilar to each other in their sequences (65% identity), although they are both composed of 121 nucleotides. Their secondary structures are generally of the eukaryotic with a prokaryotic characteristic. Judged from the 5S rRNA sequence data, the r...

متن کامل

The primary structure of oocyte and somatic 5S rRNAs from the loach Misgurnus fossilis.

Somatic and oocyte 5S rRNAs from the liver and unfertilized eggs of the loach (Misgurnus fossilis have been sequenced and found to differ in six nucleotides. All the substitutions are confined to the 5'-half of the molecules; 4 of them are pyrimidine-pyrimidine substitutions, and 2 are purine-pyrimidine ones. Considerable differences, both in the position and the character of substitutions, hav...

متن کامل

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Nucleic Acids Research

سال: 1982

ISSN: 0305-1048,1362-4962

DOI: 10.1093/nar/10.22.7405